|
Research Project:
DEVELOPMENT AND ASSESSMENT OF A SYSTEM TO PRODUCE GRASS-FED BEEF FOR THE SOUTHERN GREAT PLAINS
Location: Forage and Livestock Production Unit
Title: Associations between heat shock protein 70 genetic polymorphisms and calving traits in crossbred Brahman cows
Authors
 | Rosenkranz, Charles - |  | Brown, Michael |  | Brown, Hayden - |  | Looper, Michael - |
Submitted to: Journal of Animal Science
Publication Type: Abstract Only
Publication Acceptance Date: April 27, 2012
Publication Date: July 9, 2012
Citation: Rosenkranz, C., Brown, M.A., Brown, H., Looper, M. 2012. Associations between heat shock protein 70 genetic polymorphisms and calving traits in crossbred Brahman cows.[abstract] Journal of Animal Science. 90(3):424.
Interpretive Summary: Abstract only.
Technical Abstract:
Stressors such as heat, cold, toxins, and oxygen deprivation are known to induce heat shock proteins. Genetic polymorphisms associated with heat shock protein genes have been associated with decreased male and female fertility. Our objectives were to 1) confirm single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations among Hsp70 SNP, breed, forage system, and lifetime calving rates of multiparous cows (n = 88). Angus (n = 22), Brahman (n = 30), and reciprocal crosses (n = 36) cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or
common bermudagrass (CB). Genomic DNA was extracted from buffy
coats of EDTA-treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT)
were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Ten SNP were detected: 7 transitions (G1013A, n = 4; G1045A, n =7; C1069T, n = 8; A1096G, n = 3; G1117A, n = 36; T1134C, n = 6; and T1204C, n = 65), 2 transversions (A1125C, n = 62; and G1128T, n = 34), and one insertion/deletion at base position 895 (C895D; n = 12). Minor alleles numerically were associated with Brahman cattle; however, G1117A was the only site associated (P < 0.05) with breed with minor allele frequencies of 11, 25, and 43% respectively for Angus,
reciprocal crosses, and Brahman. Interaction (P < 0.05) between forage system and C895D genotype affected lifetime calving percentage (87, 86, 80, 85, and 20 for CC-CB, CD-CB, DD-CB, CC-E+, and DD-E+; respectively). A similar interaction (P < 0.05) was observed for G1117A and forage system. Homozygous guanine cows grazing E+ had lower (P < 0.05) lifetime calving rates when compared with GG cows grazing CB (76 vs. 90%). Our results demonstrate that Hsp70 promoter SNP will be useful in marker assisted management programs.
|
|
|
|
|