Author
TZANETAKIS, I - OREGON STATE UNIVERSITY | |
Martin, Robert |
Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal Publication Acceptance Date: 10/1/2003 Publication Date: 2/1/2004 Citation: Tzanetakis, I.E., Martin, R.R. 2004. First report of Beet pseudo yellows virus in blackberry in the USA. Plant Disease. 88:223. Interpretive Summary: Blackberry plants showing vein yellowing and chlorotic mottle were examined for the presence of virus. Symptomatic blackberry plants that tested negative for all known viruses of Rubus that can be tested for by ELISA were the source plants for this work. Double-stranded was purified and used for cloning and subsequently sequenced. Upon sequencing we found two viruses present in some of these symptomatic plants while most only contained a single virus. The most common virus has been named Blackberry yellow vein associated virus and is being studied further. The second virus was identical to a sequence of Beet pseudoyellows virus (BPYV) found in the databases. We then made primers based on the minor coat protein of BPYV and used them in reverse transcription polymerase chain reaction (RT-PCR) to detect the virus in blackberry. Amplified DNA fragments were sequenced to confirm their identity. This combination of tests showed confirmed BPYV in two different blackberry plants from South Carolina. This is the first report of BPYV in blackberry and the third new horticultural host for this virus identified in the USA in the past few months. The naturalization of the greenhouse whitefly, the vector of BPYV, in the southern United States and the broad host range of the virus and vector suggests that BPYV may be an emerging threat to for many crops in the southern United States. Technical Abstract: Blackberry (Rubus sp.) plants in Arkansas, North Carolina and South Carolina over the last three years have shown symptoms typical of virus infection including vein yellowing, line pattern, mottle and, in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from S. Carolina and identified two cDNA clones (approximately 700 and 900 bp in size, in addition to those that corresponded to sequence of BYVaV) with sequences identical to the sequence (GenBank accession No: AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog. Total RNA extracts from the symptomatic plant were tested by reverse transcription-polymerase chain reaction using oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAGATGTCCACTAATGATA 3') that amplify a fragment of the minor coat protein (CPm) of BPYV. A PCR amplicon of the expected size (334 bp) was generated and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from S. Carolina using RT-PCR. This is the first report, to our knowledge, of blackberry being a host of BPYV and the third new host of BPYV identified in the last few months. The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly, in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America. |