Author
 |
TZANETAKIS, I - OREGON STATE UNIVERSITY |
|
Martin, Robert |
|
Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal Publication Acceptance Date: 9/14/2005 Publication Date: 11/2/2005 Citation: Tzanetakis, I.E., Martin, R.R. 2005. Fragaria chiloensis cryptic virus: a new strawberry virus found in fragaria chiloensis. Plant Disease. 89:1241. Interpretive Summary: An effort to develop detection methods for all known and suspected viruses that infect strawberry is underway. During the cloning and sequencing of Fragaria chiloensis latent virus, novel sequences were obtained that suggested a second virus was present. When these unique sequences were compared to the DNA databases it showed up as a cryptic virus but also had significant homology to a host RNA polymerase from pear. Tests were developed for the novel sequences and it was found that they were present in 7/20 Fragaria chiloensis plants tested. When DNA was purified from strawberries that contained the novel sequences and subjected to PCR, no products were detected. This suggests that the sequences are not coded by the plant DNA but rather by a virus. The virus sequence we obtained suggests that the virus is a novel cryptic virus that to date has only been found in Fragaria chiloensis. Technical Abstract: Molecular characterization of Fragaria chiloensis latent virus (FClLV) was based on shotgun cloning of double-stranded RNA (dsRNA) obtained from a Chilean Fragaria chiloensis plant. While the majority of the clones acquired belonged to FClLV, several had similarities with the RNA polymerases of viruses of the Partitiviridae. A region of more than one kilobase of the putative virus was acquired by a combination of shotgun cloning and reverse transcription – polymerase chain reaction (RT-PCR)and was compared against sequences found in GenBank. The Alphacryptovirus Beet cryptic virus 3 and the RNA-dependent RNA polymerase encoded by double-stranded RNA isolated from Pyrus pyrifolia had the most significant alignments with about 40% amino acid identity and 60% amino acid similarity with the coding region of the sequenced portion of the virus. Detection primers F (5' AAGTCCGTGAGCACTGCCAT 3') and R (5' TGAATACAAGTAACGGGAATTGA 3') that amplify a 152 base pair fragment of the putative virus were developed and used for RT-PCR detection of the virus as described in 20 F. chiloensis plants obtained from the National Clonal Germplasm Repository, in Corvallis, OR. Seven of the plants were found infected with the virus as determined by RT-PCR and sequencing of the amplicons. There was no correlation between the presence of FClLV and the novel virus. In order to eliminate the possibility that the sequenced region was encoded by F. chiloensis genome, DNA was isolated (DNeasy, QIAGEN Inc., Valencia, CA), and used as template in PCR, no amplicons were obtained in these tests. The possibility that the putative virus belonged to the Endornavirus genus was also examined. The evidence suggests that this is a novel cryptic virus. |
