Skip to main content
ARS Home » Pacific West Area » Salinas, California » Crop Improvement and Protection Research » Research » Publications at this Location » Publication #203472

Title: First report of Pelargonium zonate spot virus from tomato in the United States

Author
item Liu, Hsing Yeh
item Sears, John

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 2/13/2007
Publication Date: 6/1/2007
Citation: Liu, H., Sears, J.L. 2007. First report of Pelargonium zonate spot virus from tomato in the United States. Plant Disease. 91:633.

Interpretive Summary: Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982, and later was also reported from Spain and France. Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in a tomato field in Yolo County, California. The causal agent was mechanically transmitted to several indicator species including local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annumm, C. murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. The field infected tomato plants and mechanically inoculated host plants were positive with the enzyme-linked immunosorbent assay (ELISA) using a commercial PZSV antiserum (Neogen Europe Ltd., Scotland, UK). Partially purified preparations stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 to 35 nm. We used the published sequences of PZSV (Genbank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) to design 3 sets of primer pairs specific for PZSV RNA-1, RNA2 and RNA3 for reverse transcription-polymerase chain reaction (RT-PCR) tests. Total nucleic acids were extracted from field infected tomato plants and partially purified preparations for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons revealed 92%, 94%, and 96% nucleotide sequence identity to PZSV RNA1, RNA2 and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States.

Technical Abstract: Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982, and later was also reported from Spain and France. Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in a tomato field in Yolo County, California. The causal agent was mechanically transmitted to several indicator species including local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annumm, C. murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. The field infected tomato plants and mechanically inoculated host plants were positive with the enzyme-linked immunosorbent assay (ELISA) using a commercial PZSV antiserum (Neogen Europe Ltd., Scotland, UK). Partially purified preparations stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 to 35 nm. We used the published sequences of PZSV (Genbank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) to design 3 sets of primer pairs specific for PZSV RNA-1 (R1-F: 5’ TGGCTGGCTTTTTCCGAACG 3’ and R1-R 5’ CCTAATCTGTTGGTCCGAAC TGTC 3’), RNA2 (R2-F 5’ GCGTGCGTATCATCAGAAATGG 3’ and R2-R 5’ ATCGGGAGCAGAGAAACACCTTCC 3’), and RNA3 (R3-F 5’ CTCACCAACTGAA TGCTCTGGAC 3’ and R3-R 5’ TGGATGCGTCTTTCCGAACC 3’) for reverse transcription-polymerase chain reaction (RT-PCR) tests. Total nucleic acids were extracted from field infected tomato plants and partially purified preparations for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons revealed 92%, 94%, and 96% nucleotide sequence identity to PZSV RNA1, RNA2 and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States.