Author
Lartey, Robert | |
Caesar, Thecan | |
Allen, Brett | |
Hanson, Sophia | |
Stevens, William - Bart | |
Evans, Robert |
Submitted to: Journal of Plant Pathology
Publication Type: Abstract Only Publication Acceptance Date: 2/13/2008 Publication Date: 8/1/2008 Citation: Lartey, R.T., Caesar, T., Allen, B.L., Hanson, S.L., Stevens, W.B., Evans, R.G. 2008. Examination of field soils in the Northern Rocky Mountain Region for Cercospora beticola by ELISA and PCR. Journal of Plant Pathology. 90(2):S2.81-S2.465. Interpretive Summary: As part of an ongoing nationwide survey, several fields in the Northern Rocky Mountain region were examined for Cercospora beticola. Two protocols, ELISA and PCR, were used for the examination. Soils were collected from randomly selected diverse locations that included fields under sugar beet cultivation or in rotation with other crops. Other non-cultivated areas included grassland and rangeland. These soils were then subjected to ELISA using a recently developed protocol. Additionally, total DNA was purified from the soil and subjected to PCR using C. beticola specific primers. By means of combination of the two techniques, we detected C. beticola in diverse soil from states within the Northern Rocky Mountain region. Our survey identifies areas with C. beticola and implied risk of Cercospora leaf spot incidence on susceptible crops even at locations with no history of the disease. Technical Abstract: As an integral part of an ongoing nationwide survey, we examined several fields in the Northern Rocky Mountain Region (Montana, North Dakota, Wyoming, Idaho and Colorado) for Cercospora beticola, the causal agent of Cercospora leaf spot (CLS) of sugar beet. We used enzyme-linked immunosorbent assay (ELISA) for detection of C. beticola in soil and confirmed results with PCR. Soils were randomly sampled from several areas including sugar beet fields, pasture and forest. The sugar beet fields were either under sugar beet cultivation or in rotation with other crops such as barley and safflower. Others consisted of fields with no previous history of sugar beet or have never been cultivated (i.e., rangeland, grassland). Soil samples were subjected to ELISA using pre-adsorption C. beticola specific antibodies. For PCR detection, DNA was purified from soil using PowerSoil DNA Kit (MO BIO, CA) as per the manufacturer’s instructions. The DNA was then subjected to PCR in Extract-N-Amp PCR mix (Sigma Aldrich, St Louis MO) using the C. beticola specific actin primers CBACTIN959 L (5' GTAAGTGCTGCCACAATCAGAC 3') and CBACTIN959 R (5' TACCATGACGATGTTTCCGTAG 3'). The amplicons were resolved by electrophoresis in 1% agarose gels. Using ELISA and PCR, we detected C. beticola in soil at most locations. Contrary to the hypothesis that C. beticola exists only where sugar beet is grown, soils testing positive included sites with no production of the known host plants, sugar beet and safflower. This survey identifies areas with C. beticola and risk of CLS incidence on susceptible crops even at locations with no history of the disease. |