First report of Freesia sneak virus associated with foliar necrosis of Freesia refracto in Bulgaria

Authors: BOBEV, SVETOSLAV - Agricultural University Of Bulgaria; TAPHRADJIISKI, O - Agricultural University Of Bulgaria; Hammond, John; VAIRA, ANNA MARIA - National Research Council - Italy

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 5/4/2013
Publication Date: 11/11/2013
Publication URL: http://dx.doi.org/10.1094/PDIS-01-13-0046-PDN
Citation: Bobev, S.G., Taphradjiiski, O.I., Hammond, J., Vaira, A. 2013. First report of Freesia sneak virus associated with foliar necrosis of Freesia refracto in Bulgaria. Plant Disease. 97:1514.

Interpretive Summary: Plant viruses cause significant yield and quality losses in many agricultural and horticultural crops, and visual appeal is a particularly important quality attribute of ornamental crops. As it is not economically feasible to treat virus-infected plants, disease prevention is the most effective method to reduce and prevent crop losses due to viruses, primarily by identifying the causal viruses and selecting virus-free planting materials. A severe viral disease of greenhouse-grown freesia was observed in Bulgaria in the 2011 and 2012 growing seasons. In collaborative work between Bulgarian, Italian, and American scientists, Freesia sneak virus was identified in many of the affected plants, together with Freesia mosaic virus in some plants. This was the first identification of Freesia sneak virus in Bulgaria. Identification of this virus will allow testing of future freesia propagation stock to select bulb lots free of Freesia sneak virus, and treatment of soil to prevent or minimize transmission by the fungal vector, which can both spread the virus between plants, and also serve as a reservoir of the virus in the absence of a susceptible crop. This information will allow growers and regulatory officials to impose appropriate measures to minimize both spread of the disease, and significant economic losses in freesia crops.

Technical Abstract: In the early spring of 2011, and the same period of 2012, severe necrotic symptoms were observed on freesia (Freesia refracta, Iridaceae) in several greenhouses around Plovdiv (South-central Bulgaria). The disease spread and symptom severity in several cultivars (Medeo, Calvados and Pink Fountain), led to nearly complete production failure for some growers. Initial symptoms consisted of scattered pale, chlorotic, interveinal lesions which coalesced. Later, irregular brown to black necrotic blotches partially covered the leaves. Flower break was also observed. Diseased plants were collected in late April, 2012 from one of the surveyed greenhouses, where >90% of Medeo (white-flowered) and 35-40% of Pink Fountain (pink) plants were symptomatic. Total RNA was extracted from three pooled samples of c.10 plants each, one for each cultivar and one mixed, and analyzed for Freesia sneak virus (FreSV, Ophiovirus, Ophioviridae) infection by one-step RT-PCR. Primers FOV1 (TGCTCGAATAGCCGGAACTGAA) and FOV2 (TGCTTCCAGGTGTAAGATGGCA), designed from the Italian FreSV coat protein gene (RNA 3; GenBank DQ885455), were used to specifically amplify a 466 bp fragment. The diagnostic fragment was amplified from all samples, pooled, purified and subjected to direct sequencing using the same primers. The deduced amino acid sequence had 99.8% identity with that of DQ885455, confirming FreSV infection in the symptomatic Bulgarian freesias. A diagnostic 136 bp Ophiovirus PCR product supported the diagnosis of FreSV. As severe symptoms were present in leaves and flowers of the tested freesias, a mixed infection was suspected. Several other viruses have been reported to infect cultivated freesia, so cDNA was synthesized from extracted total RNA of the Bulgarian samples using random primers, and diagnostic primers for Cucumber mosaic virus (CMV, Cucumovirus, Bromoviridae), Tobacco rattle virus (TRV, Tobravirus, Virgaviridae) and Potyvirus genus were used in PCR assays. No CMV or TRV PCR products were detected; a generic potyvirus PCR product was identified as Freesia mosaic virus (FreMV, Potyvirus, Potyviridae) by sequencing of five independent clones. Severe leaf necrosis syndrome was first described in freesia in The Netherlands before 1970, as well as England and Germany. FreMV, in mixed infection with a varicosavirus-like agent were first considered as disease agents. FreSV is now considered a candidate, at least in mixed infection, as the necrotic disease agent; it has been reported in Italy, The Netherlands, the United States, and New Zealand, in strong association with freesia necrotic disease. The presence of unidentified synergistic viral agents is suspected, and must be confirmed to aid control of this serious soil-borne disease. To our knowledge, this is the first report of FreSV on Freesia refracta in Bulgaria where necrotic disease is associated with soil-borne FreSV. The putative vector Olpidium brassicae could persist in the soil for years, and as Lachenalia hyb. (Hyacinthaceae) is also infected; therefore, attention must be paid by the growers to implement preventive control measures.