Skip to main content
ARS Home » Northeast Area » Washington, D.C. » National Arboretum » Floral and Nursery Plants Research » Research » Publications at this Location » Publication #303239
Title: First detection in the United States of Ligustrum necrotic ringspot virus in Mazus reptans with mild mosaic symptoms, in mixed infection with Cucumber mosaic virus

Author
item HENDERSON, DAVID - Former ARS Employee
item Reinsel, Michael
item FISCHER, KAEL - University Of Utah
item Hammond, John

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 6/20/2014
Publication Date: 1/22/2015
Publication URL: http://doi 10.1094/PDIS-03-14-0227-PDN
Citation: Henderson, D., Reinsel, M.D., Fischer, K., Hammond, J. 2015. First detection in the United States of Ligustrum necrotic ringspot virus in Mazus reptans with mild mosaic symptoms, in mixed infection with Cucumber mosaic virus. Plant Disease. 98(10):1446.

Interpretive Summary: Virus infection of many crops causes reduction in yield and quality; vegetatively-propagated ornamental crops are prone to accumulation of viruses transmitted either mechanically or via vectored transmission in the course of crop production. Plants of the flowering groundcover species Mazus reptans were observed to have mild mosaic symptoms typical of virus infection. Testing by electron microscopy, serology, and with a microarray designed for detection and identification of plant viruses indicated the presence of a carlavirus, Ligustrum necrotic ringspot virus, and a cucumovirus, Cucumber mosaic virus. These identifications were confirmed by nucleic acid amplification with virus-specific primers, and sequencing of the amplification products. This appears to be the first report of either of these viruses in Mazus reptans. This information will alert producers to the possible yield and quality effects of virus infection in this commonly grown ornamental species, and will allow screening to identify healthy plants for future propagation; diagnostic labs will be able to use virus-specific tests to detect and identify the viruses.

Technical Abstract: Mazus reptans N.E. Br (creeping mazus) is a perennial flowering groundcover plant in the family Scrophulariaceae. A plant of M. reptans ‘Alba’ with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy revealed the presence of slightly flexuous particles of 595-674 nm in length and smaller fragments, typical of carlaviruses. The sample was then analyzed using a recently-developed Universal Plant Virus Microarray (UPVM), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6-9-mer) primers and high copy sequence (primarily ribosomal) were reduced using Duplex Specific Nuclease. cDNA libraries were labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridized to a UPVM slide. Analysis of the UPVM hybridization results using the associated Uchip and T-Predict software identified Ligustrum necrotic ringspot virus (LNRV; genus Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; genus Cucumovirus). To confirm the UPVM results, we utilized cDNA primed with NSNC-odT, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3’ portion of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3, and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) to amplify the full CMV CP gene or internal portions. A c.1.35 kb PCR product from the LNRV-specific amplification was cloned and sequenced (GenBank acc. no. KJ187250), and found to have 84.6% nucleotide (nt) identity to the LNRV-type (EU074853), with 97.0% coat protein amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of c.600 bp, and generic primers CPTALL-5/CPTALL-3 a c.940 bp product, while no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to any of 12 characterized sgII isolates; CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. To the best of our knowledge, this is the first report of either LNRV or CMV in M. reptans, a commonly grown groundcover plant. As LNRV has previously been detected in Impatiens sp. in New Zealand (GQ411367), this virus may have a wider host range among ornamental plants than previously known, and the mild mosaic symptoms even in a mixed infection with CMV may hinder detection. M. reptans may thus serve as a conduit for distribution of LNRV to other ornamentals including Impatiens spp.