Skip to main content
ARS Home » Northeast Area » Beltsville, Maryland (BARC) » Beltsville Agricultural Research Center » National Germplasm Resources Laboratory » Research » Publications at this Location » Publication #322665
Title: First report of Tomato spotted wilt virus on celery in China

Author
item LI, Y.Y - Yunnan Agricultural University
item XIAO, L - Yunnan Agricultural University
item TAN, G.L. - Yunnan Agricultural University
item FU, X.P. - Yunnan Agricultural University
item Li, Ruhui
item LI, F - Yunnan Agricultural University

Submitted to: Plant Disease
Publication Type: Research Notes
Publication Acceptance Date: 5/1/2015
Publication Date: 5/2/2015
Citation: Li, Y., Xiao, L., Tan, G., Fu, X., Li, R., Li, F. 2015. First report of Tomato spotted wilt virus on celery in China. Plant Disease. 99:734-735.

Interpretive Summary:

Technical Abstract: Celery (Apium graveolens L.) is widely cultivated in most parts of China as an important and high-value cash crop. In June 2013, irregular chlorotic blotches, necrotic flecks, concentric ring spots, and shrinking symptoms were observed on leaves of celery plants in fields of Tonghai County, Yunnan Province of China. The disease incidences ranged from 5 to 20% in the field. Leaf samples were initially collected from 12 symptomatic plants and tested by dot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus, Tomato spotted wilt virus (TSWV), and Turnip mosaic virus (kindly provided by Xueping Zhou of Zhejiang University, China). Eight of these samples reacted positively with the TSWV antibody. For further confirmation of TSWV infection, total nucleic acids were extracted from the same 12 samples using a CTAB method (Li et al. 2008) and were used as templates in reverse-transcription (RT)-PCR. A pair of TSWV-specific primers, TSWVF (TCACTGTAATGTTCCATAGCAA) and TSWVR (AGAGCAATYGTGTCAATTTTATTC) described by Yin et al. (2013), were used to amplify a portion of the S RNA segment of TSWV in RT-PCR. Amplicons of approximately 800 bp were obtained from the eight ELISA-positive samples. Two of the amplicons, YTHa-QC4 and YTHa-QC8, were purified with Universal DNA Purification Kit (TIANGEN Biotech Co.) and directly sequenced. An NCBI BLAST search of the obtained sequences (Accessions Nos. KP034959 and KP034960) revealed that the two isolates shared the highest nucleotide sequence identity of 95 to 99% with those of other TSWV isolates available in GenBank. Both of the YTHa-QC4 and YTHa-QC8 isolates were most closely related to three TSWV Chinese isolates, two from tomato (HQ402595 and JF960235) and one from lettuce (JN664252), and to one Korean isolate from pepper (KC261949). Sap of the TSWV-positive celery plants were mechanically inoculated on 15 healthy celery plants. All inoculated plants produced chlorotic blotches, and some of them showed concentric ring spot symptoms. The TSWV infection of the inoculated plants was further confirmed by RT-PCR and sequential sequencing. The results indicated that the celery disease from Tonghai was caused by TSWV. To study the TSWV distribution, 88 more symptomatic celery samples were collected from Tonghai and five other counties (Jiangchuan, Jianshui, Xundian, Songming, and Dali) of Yunnan Province. The virus was detected in 22 celery samples from Tonghai, Xundian, and Songming, suggesting that the occurrence of TSWV in celery is common in the field. Infection of TSWV in celery has been reported in several other countries such as New Zealand and Australia. To our knowledge, this is the first report of TSWV infecting celery in China. TSWV has also been reported to infect other important vegetable crops, including eggplant, lettuce, pepper, potato, and tomato in China. Therefore, effective management strategies should be taken to control this virus in vegetable production.