Skip to main content
ARS Home » Northeast Area » Beltsville, Maryland (BARC) » Beltsville Agricultural Research Center » National Germplasm Resources Laboratory » Research » Publications at this Location » Publication #328549
Title: First report of zucchini tigre mosaic virus infecting several cucurbit plants in China

Author
item XIAO, LONG - Yunnan Agricultural University
item LI, YUEYUE - Yunnan Agricultural University
item TAN, GUILING - Yunnan Agricultural University
item LAN, PINGXIU - Yunnan Agricultural University
item ZHONG, LI - Yunnan Academy Of Agriculture Sciences
item Li, Ruhui
item LI, FAN - Yunnan Agricultural University

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 1/4/2016
Publication Date: 1/12/2016
Citation: Xiao, L., Li, Y., Tan, G., Lan, P., Zhong, L., Li, R., Li, F. 2016. First report of zucchini tigre mosaic virus infecting several cucurbit plants in China. Plant Disease. 100:1253.

Interpretive Summary: Cucurbit crops such as pumpkin, cucumber and zucchini are important vegetable crops worldwide. Many viruses infect them causing economically important diseases. These result in significant yield losses, and also distortion and discolorations of fruit that make them less marketable. In this study, Zucchini tigre mosaic virus (ZTMV) was identified from diseased pumpkin plants in the Yunnan province of China. The disease incidence, based on symptom observations, was 80% to 90%. Molecular and biological assays were used to confirm the association of the virus with the disease. The virus was also detected from cucumber and zucchini. This is the first report of ZTMV infecting cucurbit plants in China. This information is useful for scientists who study viruses of vegetable crops and develop disease management strategies.

Technical Abstract: Pumpkin (Cucurbita moschata Duch.), Cucumber (Cucumis sativus Linn.) and Zucchini (Cucurbita pepo Linn.) are important crops in tropical and subtropical regions in the world, and they are popular vegetable crops in China. There are currently 59 viruses known infecting cucurbit plants which including eleven species in the genus Potyvirus. Zucchini tigre mosaic virus (ZTMV) was firstly observed from zucchini fields in Guadeloupe (French West Indies) as a divergent strain of Papaya ringspot virus (PRSV) in 1982, but biological, serological and molecular biology studies revealed that it should be a distinct species in the genus Potyvirus (Romay et al. 2014). In July 2014, foliage shrinking, blistering, mosaic, mottling, chlorotic and dark-green vein banding were observed in pumpkin fields near Yuxi city, Yunnan province of China. The disease incidence based on symptom observation was 80% to 90%. Thirteen symptomatic pumpkin leaf samples were collected and tested by dot-enzyme linked immunosorbent assay (dot-ELISA) with universal potyvirus group monoclonal antibody (Agdia, Inc., USA). Ten out of the 13 samples reacted positively, suggesting the presence of potyviruses in the samples. Total nucleotide acids were then extracted from the 13 samples using a CTAB-based method (Li et al. 2008). Reverse-transcription (RT)-PCR was performedwith a pair of potyvirus degenerate primers CIFor (GGIVVIGTIGGIWSIGGIAARTCIAC) and CIRev (ACICCRTTYTCDATDATRTTIGTIGC). Fragments with predicted size of approximately 700 bp were amplified from the 10 ELISA-positive samples. The amplicons of two isolates (YJCh-NG1 and YJCh-NG13) were cloned and sequenced. NCBI BLAST search showed YJCh-NG1 (KR259540) and YJCh-NG13 (KR360723) shared nucleotide identities of 86% with other ZTMV isolates. To confirm the pathogenicity of ZTMV on pumpkin, sap of ZTMV-positive pumpkin were mechanically inoculated onto healthy pumpkin plants. Symptoms similar to the field diseased plants were observed on the inoculated plants after about 14 days. Infection of ZTMV on the inoculated pumpkin plants were confirmed by RT-PCR using virus-specific primers ZTMVdF (GCATTAAGTTTACGACAGCGC) and ZTMVdR (CAATCACTCTTGTCRGTGTC). ZTMV was also detected from cucumber and zucchini by RT-PCR in Shiping county and Kaiyuan city, Yunnan province of China, respectively. Two isolates, SP-HG2 from cucumber and KY-XHL2 from zucchini, were amplified by and sequenced. Sequence analysis confirmed its infection on cucumber and zucchini. ZTMV has probably long been overlooked because of its close relationship to Papaya ringspot virus (PRSV) and its high frequency of co-infection with PRSV (Romay et al. 2014). To our knowledge, this is the first report of ZTMV infecting cucurbit plants in China.