Skip to main content
ARS Home » Northeast Area » Washington, D.C. » National Arboretum » Floral and Nursery Plants Research » Research » Publications at this Location » Publication #359270
Research Project: Detection, Identification, and Characterization of New and Emerging Viral and Bacterial Diseases of Ornamental Plants

Location: Floral and Nursery Plants Research

Title: First report of Zucchini yellow mosaic virus in muskmelon (Cucumis melo) in Korea

Author
item CHO, IN-SOOK - Rural Development Administration - Korea
item CHUNG, BONG-NAM - Rural Development Administration - Korea
item KWON, S.J. - Rural Development Administration - Korea
item YOON, J.Y. - Rural Development Administration - Korea
item CHOI, G.S. - Rural Development Administration - Korea
item KIM, BORAM - Chungnam National University
item KWAK, Y.H. - Chungnam National University
item Hammond, John
item LIM, HYOUN-SUB - Chungnam National University

Submitted to: Journal of Plant Pathology
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 12/29/2018
Publication Date: 1/16/2019
Citation: Cho, I., Chung, B., Kwon, S., Yoon, J., Choi, G., Kim, B., Kwak, Y., Hammond, J., Lim, H. 2019. First report of Zucchini yellow mosaic virus in muskmelon (Cucumis melo) in Korea. Journal of Plant Pathology. 101(3):771. https://doi.org/10.1007/s42161-018-00239-6.
DOI: https://doi.org/10.1007/s42161-018-00239-6

Interpretive Summary: Plant virus infections cause losses of yield and quality in many crops; viruses can spread readily by horticultural practices or transmission via specific vectors. New virus variants may arise by mutation, or may be introduced by seed or propagation materials or by wind-blown insect vectors. Scientists in Korea detected Zucchini yellow mosaic virus (ZYMV) for the first time in greenhouse muskmelon crops in Korea. This virus caused up to 90% losses in muskmelon. Knowledge about the presence of this virus will be useful to growers, extension agents, and plant breeders, who may be able to breed or select muskmelon varieties with resistance to the virus.

Technical Abstract: Green vein-banding and severe mottle on the leaves of Cucumis melo L. (muskmelon cv. ‘Santafe’) were observed in plants grown in almost 90% of plastic houses examined in Wanju, Korea in 2017. Disease incidence of >90%, and losses of 90% were estimated across 15 plastic houses (6,600 m²). Flexuous filamentous particles (approximately 710 x 13 nm) typical of potyviruses were observed by electron microscopy from leaves with virus-like symptoms. The presence of two potyviruses infecting Cucurbitaceae, Zucchini yellow mosaic virus (ZYMV) and Watermelon mosaic virus, was tested by RT-PCR. The presence of other viruses infecting Cucurbitaceae, Cucumber mosaic virus, Cucurbit aphid-borne yellow virus, Tobacco ringspot virus and Squash mosaic virus was screened by RT-PCR using specific primers (data not shown). Results showed that ZYMV, but no other cucurbit virus, was detected. To confirm specific amplification of ZYMV, PCR products of the coat protein (CP) gene (primers ZYMV-895-For: CAAGGAGACACCGTAATGCTCCAA/ZYMV-895-Rev: TGCATTGTTCACACCTAACAGG; designed based on a multiple sequence alignment) were sequenced and submitted to GenBank as accession no. MF804411. The ZYMV isolate identified is this study was named ZYMV-me-SR. We compared phylogenetic relationships between ZYMV-me-SR and selected other CP nucleotide sequences, previously used to determine the phylogenetic grouping of ZYMV isolates isolated from melon in China (Wang and Li 2017). A phylogenetic tree constructed by the neighbor-joining method with 1000 bootstrap replications using MEGA 7 (Kumar et al., 2016) showed that ZYMV-me-SR clustered in group A of Wang and Li (2017). Although ZYMV was first reported to infect melon crops in 1979 (Lecoq et al., 1981), to our knowledge this is the first report of occurrence of ZYMV in Cucumis melo L. (muskmelon) in Korea.