First report of Pepino mosaic virus infecting tomato in Korea

Authors: CHO, IN-SOOK - National Institute Of Horticultural & Herbal Science (NIHHS); CHUNG, BONG-NAM - National Institute Of Horticultural & Herbal Science (NIHHS); YOON, JU-YEON - Jeonbuk National University; Hammond, John; LIM, HYOUN-SUB - Chungnam National University

Submitted to: Plant Disease
Publication Type: Peer Reviewed Journal
Publication Acceptance Date: 5/2/2022
Publication Date: 5/10/2022
Citation: Cho, I., Chung, B., Yoon, J., Hammond, J., Lim, H. 2022. First report of Pepino mosaic virus infecting tomato in Korea. Plant Disease. https://doi.org/10.1094/PDIS-02-22-0380-PDN.
DOI: https://doi.org/10.1094/PDIS-02-22-0380-PDN

Interpretive Summary: Plant viruses often cause losses of both yield and quality in agricultural crops, and cannot be easily controlled once present in the crop. Introduction of additional viruses into a region where they have not previously occurred is cause for concern, requiring management to limit further spread and adverse economic impacts. Pepino mosaic virus, which can be transmitted on seeds harvested from infected plants, has caused yield and quality losses in many other countries over the past two decades, was discovered in South Korea for the first time, in greenhouse-grown tomatoes. Knowledge of the presence of this virus will facilitate testing and preventative treatment of seed lots to minimize the potential impacts of this virus on tomato production in South Korea, where tomato is a major vegetable crop, to the benefit of farmers and consumers.

Technical Abstract: Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in Korea. In December 2020, virus-like symptoms were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, Korea, showing unevenly discolored fruits and foliar interveinal chlorosis. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing. After preprocessing and Ribo-Zero rRNA removal, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717); the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6419 and 6391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities to isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the affected greenhouse were subjected to reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank (accession no. LC637518 and LC637517), showing 97.28% and 94.69% nt identity with the corresponding 625 nt of a US1 strain (FJ940225) and 848 nt of a CH2 strain (JN835466), respectively. Newly-designed primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of strains CH2 and US1; PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between JKT1-derived (LC683791 and LC683792) and JKT2-derived (LC683793 and LC683794) sequences, further supporting the presence of mixed infections in all of the samples. To our knowledge, this is the first report of PepMV infecting tomato in Korea. PepMV is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and very efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and thus may be a serious threat to tomato production in Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.