Skip to main content
ARS Home » Southeast Area » Houma, Louisiana » Sugarcane Research » Research » Publications at this Location » Publication #340585
Title: Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species

Author
item Pan, Yong-Bao
item Todd, James
item Scheffler, Brian
item Hale, Anna
item Lomax, Lionel
item Simpson, Sheron
item LIU, FANNY - Collaborator
item Grisham, Michael

Submitted to: American Society of Sugar Cane Technologists
Publication Type: Abstract Only
Publication Acceptance Date: 4/11/2017
Publication Date: 6/14/2017
Citation: Pan, Y., Todd, J.R., Scheffler, B.E., Hale, A.L., Lomax, L.E., Simpson, S.A., Liu, F., Grisham, M.P. 2017. Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species [abstract]. Journal of the American Society of Sugar Cane Technologists. 37:32.

Interpretive Summary:

Technical Abstract: The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR primers trnL-c (5’ NED-CGAAATCGGTAGACGCTA CG) and trnF-f (5’ ATTTGAACTG GTGACACGAG) were used to amplify DNA fragments from the trnL and trnF non-coding regions of chloroplast genomes of 161 accessions of six Saccharum species, nine sugarcane cultivars, and one accession each of three Erianthus species. The resulting amplicons were subject to capillary electrophoresis on a genetic analyzer ABI3730XL (www.appliedbiosystems.com) along with GeneScanTM Size Standards GS1200 (LIZ) to generate <.fsa> files, which were processed by the GeneMarker® software to visualize PCR amplicons of different sizes. Only four DNA fragments of 934, 950, 955, or 996 bp long were observed. The 950-bp amplicon was the most common with 162 accessions (93.6%). The 934 bp c/f-amplicon was less common with nine accessions (5.2%), of which eight were S. spontaneum and one was Erianthus procerus (Accession Kalimpong). The 955 and 996 bp c/f-amplicons were the least common, each was found in one accession (0.6%) belonging to either S. spontaneum (Accession IN84-010) or Erianthus bengalense (Accession IMP9751). To further explore the nucleotide sequence variability, each region was amplified via PCR with the primer pair trnL-c/trnL-d (5’ GGGGATAGAGGGA CTTGAAC) or trnL-e (GGTTCAAGTCCCTCTATCCC)/trnF-f. All amplicons were purified with Zymo ZR-96 DNA Sequencing Clean-up Kit (Z4053) (www.zymoresearch.com) and are currently being directly sequenced using the BigDye Terminator V3.1 Cycle Sequencing Kit (www.appliedbiosystems.com) on ABI 3730XL DNA Analyzer. The sequencing files will be analyzed using DNASTAR’s SeqMan® (www.dnastar.com) and DNAMAN® (www.lynnon.com) to determine the exact sizes of the amplicons and sequence variations in terms of insertion, deletion, transition and transversion. The results can be used to assess the phylogenetic relationship among these accessions and determine which accession(s) may have contributed cytoplasm to modern sugarcane cultivars.